Browse by type
Ultrafast preprocessing and quality control for long reads (Nanopore, PacBio, Cyclone, etc.).
If you're searching for tools to preprocess short reads (Illumina, MGI, etc.), please use fastp
fastplong supports batch processing of multiple FASTQ files in a folder, see - batch processing
fastplong -i in.fq -o out.fq
Both input and output can be gzip compressed. By default, the HTML report is saved to fastplong.html (can be specified with -h option), and the JSON report is saved to fastplong.json (can be specified with -j option).
fastplong creates reports in both HTML and JSON format.
* HTML report: http://opengene.org/fastplong/fastplong.html
* JSON report: http://opengene.org/fastplong/fastplong.json
conda install -c bioconda fastplong
This binary was compiled on CentOS, and tested on CentOS/Ubuntu
# download the latest build
wget http://opengene.org/fastplong/fastplong
chmod a+x ./fastplong
# or download specified version, i.e. fastplong v0.2.2
wget http://opengene.org/fastplong/fastplong.0.2.2
mv fastplong.0.2.2 fastplong
chmod a+x ./fastplong
fastplong depends on libdeflate and isa-l for fast decompression and compression of zipped data, and depends on libhwy for SIMD acceleration. It's recommended to install all of them via Anaconda:
conda install conda-forge::libdeflate
conda install conda-forge::isa-l
conda install conda-forge::libhwy
You can also try to install them with other package management systems like apt/yum on Linux, or brew on MacOS. Otherwise you can compile them from source (https://github.com/intel/isa-l, https://github.com/ebiggers/libdeflate, and https://github.com/google/highway)
# get source (you can also use browser to download from master or releases)
git clone https://github.com/OpenGene/fastplong.git
# build
cd fastplong
make -j
# test
make test
# Install
sudo make install
Specify input by -i or --in, and specify output by -o or --out.
* if you don't specify the output file names, no output files will be written, but the QC will still be done for both data before and after filtering.
* the output will be gzip-compressed if its file name ends with .gz
fastplong supports streaming the passing-filter reads to STDOUT, so that it can be passed to other compressors like bzip2, or be passed to aligners like minimap2 or bowtie2.
* specify --stdout to enable this mode to stream output to STDOUT
--stdin if you want to read the STDIN for processing.--failed_out to specify the file name to store the failed reads.--failed_out, its failure reason will be appended to its read name. For example, failed_quality_filter, failed_too_short etc.If you don't want to process all the data, you can specify --reads_to_process to limit the reads to be processed. This is useful if you want to have a fast preview of the data quality, or you want to create a subset of the filtered data.
You can enable the option --dont_overwrite to protect the existing files not to be overwritten by fastplong. In this case, fastplong will report an error and quit if it finds any of the output files (read, json report, html report) already exists before.
See output splitting

Multiple filters have been implemented.
Quality filtering is enabled by default, but you can disable it by -Q or disable_quality_filtering.
fastplong supports filtering by limiting the N base number (--n_base_limit, disabled by default) and N base percentage (-n, --n_percent_limit, enabled by default). For example, to limit the N base no more than 100, and no more than 20%, you can use the command:
fastplong -i in.fq -o out.fq --n_base_limit 100 --n_percent_limit 20
To filter reads by its percentage of unqualified bases, two options should be provided:
* -q, --qualified_quality_phred the quality value that a base is qualified. Default 15 means phred quality >=Q15 is qualified.
* -u, --unqualified_percent_limit how many percents of bases are allowed to be unqualified (0~100). Default 40 means 40%
You can also filter reads by its average quality score
* -m, --mean_qual if one read's average quality score <avg_qual, then this read is discarded. Default 0 means no requirement (int [=0])
Length filtering is enabled by default, but you can disable it by -L or --disable_length_filtering. The minimum length requirement is specified with -l or --length_required.
You can specify --length_limit to discard the reads longer than length_limit. The default value 0 means no limitation.
New filters are being implemented. If you have a new idea or new request, please file an issue.
fastplong trims adapter in both read start and read end. Adapter trimming is enabled by default, but you can disable it by -A or --disable_adapter_trimming.
fastplong -i in.fq -o out.fq -s AAGGATTCATTCCCACGGTAACAC -e GTGTTACCGTGGGAATGAATCCTT
If the adapter sequences are known, it's recommended to specify -s, --start_adapter for read start adapter sequence, and -e, --end_adapter for read end adapter sequence as well.
If --end_adapter is not specified but --start_adapter is specified, then fastplong will use the reverse complement sequence of start_adapter to be end_adapter.
You can also specify -a, --adapter_fasta to give a FASTA file to tell fastplong to trim multiple adapters in this FASTA file. Here is a sample of such adapter FASTA file:
>Adapter 1
AGATCGGAAGAGCACACGTCTGAACTCCAGTCA
>Adapter 2
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT
>polyA
AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
The adapter sequence in the FASTA file should be at least 6bp long, otherwise it will be skipped. And you can give whatever you want to trim, rather than regular sequencing adapters (i.e. polyA).
If all these adapter options (start_adapter, end_adapter and adapter_fasta) are not specified, fastplong will try to detect the read start and read end adapters automatically. The detected adapter sequences may be a bit shorter or longer than the real ones. And there is a certain probability of misidentification, especially when most reads don't have adapters (it won't cause too bad result in this case).
fastplong calculates edit distance when detecting adapters. You can specify the -d, --distance_threshold to adjust the mismatch tolerance of adapter comparing. The default value is 0.25, which means allowing 25% mismatch ratio (i.e. allow 10 distance for 40bp adapter). Suggest to increase this value when the data is much noisy (high error rate), and decrease this value when the data is with high quality (low error rate).
to make a cleaner trimming, fastplong will trim a little more bases connected to the adapters. This option can be specified by --trimming_extension, with a default value of 10.
fastplong supports per read sliding window cutting by evaluating the mean quality scores in the sliding window. fastplong supports 2 different operations, and you enable one or both:
* -5, --cut_front move a sliding window from front (5') to tail, drop the bases in the window if its mean quality is below cut_mean_quality, stop otherwise. Default is disabled. The leading N bases are also trimmed. Use cut_front_window_size to set the widnow size, and cut_front_mean_quality to set the mean quality threshold. If the window size is 1, this is similar as the Trimmomatic LEADING method.
* -3, --cut_tail move a sliding window from tail (3') to front, drop the bases in the window if its mean quality is below cut_mean_quality, stop otherwise. Default is disabled. The trailing N bases are also trimmed. Use cut_tail_window_size to set the widnow size, and cut_tail_mean_quality to set the mean quality threshold. If the window size is 1, this is similar as the Trimmomatic TRAILING method.
fastplong can detect low quality regions by moving a sliding window through the read. Specify -b or --break to enable this feature. You can adjust the sliding window size by --break_window_size, and adjust the mean quality requirement by break_mean_quality.
The subreads will have names like @r1-original-name, @r2-original-name..., and each subread will be quality checked and filtered separately.
WARNING: This may result in significant data loss. If you want to keep more data, please lower the mean quality requirement or improve the sliding window size.
fastplong can detect low quality regions and replace the bases in these regions with N base. Specify -N or --mask to enable this feature. You can adjust the sliding window size by --mask_window_size, and adjust the mean quality requirement by mask_mean_quality.
WARNING: This may cause many reads failed to pass the N base limit filter. If you want to keep more data, you can lower the mean quality requirement, improve the sliding window size or adjust the N base percent limit --n_percent_limit.
It's not suggested to enable both --break and --mask together. But if they are enabled together, fastplong will break the reads first, and then mask the subreads.
fastplong supports global trimming, which means trim all reads in the front or the tail. This function is useful since sometimes you want to drop some cycles of a sequencing run.
For example, the last cycle is uaually with low quality, and it can be dropped with -t 1 or --trim_tail=1 option.
-f, --trim_front and -t, --trim_tail.For parallel processing of FASTQ files (i.e. alignment in parallel), fastplong supports splitting the output into multiple files. The splitting can work with two different modes: by limiting file number or by limiting lines of each file. These two modes cannot be enabled together.
The file names of these split files will have a sequential number prefix, adding to the original file name specified by --out1 or --out2, and the width of the prefix is controlled by the --split_prefix_digits option. For example, --split_prefix_digits=4, --out1=out.fq, --split=3, then the output files will be 0001.out.fq,0002.out.fq,0003.out.fq
Specify --split to specify how many files you want to have. fastplong evaluates the read number of a FASTQ by reading its first ~1M reads. This evaluation is not accurate so the file sizes of the last several files can be a little differnt (a bit bigger or smaller). For best performance, it is suggested to specify the file number to be a multiple of the thread number.
Specify --split_by_lines to limit the lines of each file. The last files may have smaller sizes since usually the input file cannot be perfectly divided. The actual file lines may be a little greater than the value specified by --split_by_lines since fastplong reads and writes data by blocks (a block = 1000 reads).
parallel.py is a script to preprocess all FASTQ files within a folder in parallel. It will automatically couple the paire
$ claude mcp add fastplong \
-- python -m otcore.mcp_server <graph>